Snoscan Methylation File Format

A methylation file can be created for each target RNA sequence (i.e. rRNAs) to specify the positions that are known or expected to be 2'-O-ribose methylated. These sites are usually based on biochemical evidence, or inferred from related species with reliable methylation site data.

The basic format for a methylaiton file is

>Target-seq-name1
N  Number  "My comment"

Where:
"Target-seq-name1" MUST match the name of the sequence in the target sequence FASTA file,
"N" is A,C,G, or T and must match the letter at that position in the target sequence,
"Optional comment" is any free text up to 60 characters (i.e. "Site modified by U14").
Whitespace characters (tab, single or multiple spaces) separates these three fields.

Multiple methylation sites for multiple sequences can be specified in one file, and do not need to appear in the same order as in the target sequence FASTA file (but the sequence names MUST match). Also, you do NOT need to supply methylation information for each target sequence, just those you have data for.

For example, if you submitted this FASTA target sequence to the server:

>My-seq-A  small subunit ribosomal sequence from my favorite organism
TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCC
ATGCATGTCTAAGTATAAGCAATTTATACAGTGAA
>My-seq-B  large subunit ribosomal sequence from my favorite organism
GATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTG

Then the methylation file specifying sites in these target sequences might look like:

>My-seq-A
T 5   Verified meth site by TML
C 12  Predicted by snoscan
A 51  Known target of U21
>My-seq-B
G 1   Partially modified site
A 6   Mapped by Maden

See the sample yeast and human methylation site files on the main search page for more examples.